Vida

De Inciclopedia

Saltar a: navegación, buscar
Exito meme This article ha sido traducido de la Uncyclopedia por algún listillo
que nos quiere restregar por las narices su pedazo de nivel de inglés


Cita3La vida es un carnaval, no hay que llorar.Cita4
Celia Cruz sobre la vida
Cita3No tengo ni la más mínima idea.Cita4
sobre la vida
Cita3Si la vida te da la espalda, métele el dedo en el culo.Cita4
Anónimo sobre la vida
Cita3Lo que los Frikis no tienenCita4
Nerd juzgando a los demas por su propia condicion
Cita3Si la vida es larga y dura, echale un balde de agua fria.Cita4
Otro anónimo sobre la vida.
Cita3¿Una vida? ¡Genial! ¿Dónde puedo descargar una de esas?Cita4
Estudiante de informática sobre la vida.
Cita3La vida es como el palo de un gallinero: es corta y llena de mierdaCita4
Aristóteles sobre la vida.
Cita3La vida es lo que nos pasa mientras estamos ocupados haciendo otras cosasCita4
John Lennon sobre la vida.
Cita3La vida es lo que nos pasa mientras estamos ocupados navegando en internet, chateando y leyendo comicosCita4
Friki sobre la vida.
Cita3La alegría de vivir, tú la puedes compartir / sólo debes de sentirla dentro de tu corazón.Cita4
Mónica Santamaría antes de suicidarse.
Cita3La vida es como un moco: dura,intragable y a veces no te deja respirarCita4
Primer anonimo sobre la vida.

La vida es una enfermedad mortal incurable de alta transmisión sexual transmitida por tu mamá que se encuentra en el 99.99% de la población humana (exceptuando a los infectados por los Laboratorios Umbrella, claro está) a cuyos enfermos les suceden una serie de acontecimientos inesperados entre el nacimiento (conocida como reclamación del concepto (la concepción), o contracciones uterinas dolorosas parto o dar la luz) y su inevitable y muchas veces dolorosa muerte (AKA la descomposición o putrefacción del cuerpo), que con tratamiento, cuidados intensivos puede llegar a ser llevadera durante 60 años y con Dios de tu lado, y una suerte de cojones puedes soportarla hasta 120 años como máximo. La vida ha sido el sujeto de investigación y conocimiento de filósofos, científicos locos (como Albert Einstein), musas y artistas desde hace millones de años, pero nadie aún ha encontrado su verdadera cura. Cada cultura principal ha intentado desenredar los misterios de vida. Por suerte, nadie ha sido capaz de desenredar estos misterios y los que lo han intentado los han liado más.

Bebefeo
Un recién llegado, explorando qué es esto de la vida.

[editar] Definición

Cita3Si quieres ser positivo, pierde electronesCita4
Anónimo sobre la vida.

En una ocasión Woody Allen se acercó a sus discípulos y les dijo:

Cita1¿Conocen este chiste? Dos señoras de edad están en un hotel de alta montaña y dice una: -¡Vaya!, aquí la comida es realmente terrible - y contesta la otra: -Sí y además las raciones son tan pequeñas. Pues básicamente así es como me parece la vida, llena de soledad, misterio, sufrimiento, tristeza... y sin embargo se acaba demasiado deprisa.Cita2

“¿Por qué piensa usted que me marché? " dijo algún tipo famoso muerto. "La gente cree que si usted es una persona que piensa que la botella esta medio vacía o medio llena el significado de vida es diferente. La vida es el acto de vida, o la vida es el acto de no estar muerta. Ambos pensamientos estan equivocados, la vida es el acto de no estar inmuertos. " – Extraido del tratado del dios sobre vida.

Algunos frikis filósofos han definido la vida, como “un FPS (First Person Shooter) con peores gráficos ".

[editar] Origen

Mientras nadie conoce con seguridad "el cuando" del origen de vida, "el donde" parece ser en el agua. El origen de vida era un asunto complejo. Se cree que Dios creó la vida en respuesta a una apuesta que hizo con Hares. Este último apostó que si creaba seres vivos no podían alcanzar la inteligencia independiente. Es todavía desconocido quien ganó la apuesta. En realiadad, la vida se remonta a tiempos antiquísismos, a antes que aparecieran los primeros seres vivos sobre la tierra, y es cuando Dios tuvo vida, se cree que mandó un rayo cósmico que cayó sobre una molécula de plutonio que a su vez generó un litro de agua pesada, dentro de la cual se desarrolló la primer molécula de acido ribonucléico que dio origen a la vida. Empezó con forma de alga, pero no era divertido porque no podía moverse de aquí para allá, sólo lo que la marea la movía, así que fue transformandose en ameba para poder desplazarse con mas comodidad y para su mayor maniobrabilidad desarrolaron aletas. Un día una de éstas asomó la cabeza fuera del agua y vió que estaba la tiera llena de comida y decidió arrastrarse agunatando la respiración, y se arrastró por varios kilómetros hasta que empezó a desarrollar pulmones. Fue entonces que los que no se animaron quedaron en peces y los que si se convirtieron en terrícolas, fue desde entonces que la máxima ambición de los terrícolas es convertirse en multimillonarios y la de los peces , sólo llegar a tiburón, y por ese resentimiento ancestral cada tanto se manducan un bañista. Otra teoría menos popular declara que la vida era el resultado de una reacción química rara del Litio (Li) y el Hierro (Fe). Se han hecho bastantes esfuerzos en laboratorios para verificar que la teoría hasta ahora sólo ha conducido a la Muerte, que generalmente, como se considera, la parte de enfrente de vida.

[editar] El comienzo

Tumba+geek-9779
Esto no es vida.

El principio de la vida es un tema que da mucho que debatir. Algunas personas declaran que la vida comienza en el nacimiento, en el concepto (la concepción), y otros opinan que comienza cuando los niños se mudan. Generalmente se ha llegado al acuerdo de que la vida, por lo general, proviene en alguna capacidad como consecuencia de la nigromancia o del sexo. El último método es algo más popular. La combinación de los dos generalmente no es vista con buenos ojos en la sociedad. Excepto yo los zombis, nadie puede recordar el principio de su propia vida. Esto nos conduce a una única conclusión: El nacimiento es una ilusión, y somos atrapados todos en una falsa realidad de cual sólo el Culto, y los zombis, pueden escapar.

[editar] Procedimientos

Mientras la vida pasa a través de una amplia variedad de planta y especimenes, llamados animales, el proceso básico de vida pueden ser estropeado en una serie de pasos comunes a todos:

[editar] Comer y beber

Requieren alimento y alchol agua para el sustento de vida. Irónicamente la mayor parte del alimento del mundo es sacado de la muerte de otro ser vivo. El comer puede ser hecho de muchas maneras: la absorción de la luz del sol, sustancias nutritivas que crecen gracias a algunos líquidos, consumiendo las partículas carnosas de otras formas de vida, y chupando la sangre dulce de sus primos sobrenaturales, los vampiros, son solamente algunos de los métodos más comunes. En algunos casos se ha comprobado, especialmente en algunas religiones indúes, que no es necesario ingerir alimentos para subsistir, hay experimentos de un joven indú que permaneciendo en estado de trance y meditación, estuvo tres meses sin tomar ni beber absolutamente nada. Esto ha tenido difusión mundial y ha sido tomado por las cámaras de TV, los mas agnósticos han quedado asombrados ante tal evidencia, tal fue su repercusión que Capitanich, el goberndor de Chaco en Argentina lo quiso traer al su provincia para dar cursos de cómo sobrevivir sin comer, a lo cual los indúes se negaron, porque consideraron que era un abuso. Algunas culturas se complacen consumiendo los fetos subdesarrollados de los animales más pequeños, como pollos, avestruces o el pescado. Se sabe que algunos humanos consumen los fluidos reproductivos de las vacas, incluso a veces de cabras. Ellos llaman este proceso " bebiendo la leche ", pero esto es realmente un complot comunista de derrocar el gobierno búlgaro.

Un subproducto preciso de comer son los desechos radiactivos, conocidos en el reino animal como "mierding". Pero recuerda que todo lo que entra debe salir, así que no hay problema.

[editar] Dormir

Cachorros
Esta es la vida que todos quisiéramos llevar

También requieren dormir para seguir viviendo. Pero el intento de hacerlo demasiado (entre 12 y 24 horas) puede provocar la muerte. Algunos habitantes de determinados países duermen mucho,generalmente son los de clase social mas baja, planes sociales, empleados municicpales etc., por desgracia no sucede lo mismo con la clase gobernante, pues se ahorrarían un montón de dinero y problemas ya que cuando éstos están despiertos sólo hacen cagadas. titulus nexus externi

[editar] Follar

El virus de la vida se vale de una apabullante y compleja técnica de hormonas y estimulantes químicos transmitidos al cerebro del paciente que le provocan unas ansias irresistibles de juntar sus organos genitales con los de otro infectado (a lo que se le llama sexo) y de ese modo poder seguir existiendo en la próxima generación de infectados, pues los existentes están apunto de morir (Si no en meses, en unos cuantos años mas, al tiempo). Es por eso que siempre se ha mantenido como un tabú. No es necesario que tengan relaciones sepsuales para que se mantengan vivos, pero si se es un famoso poco conocido le vendrá bien para hacerse publicidad en la prensa del corazón.

Cita3Yo no uso de eso.Cita4
Oscar Wilde sobre sepso

[editar] Morir

No exactamente una parte de vida, pero sí es la pérdida de ella. Sin vida no podria haber muerte, y talvez sin muerte no habria vida, seria existencia solamente. A decir verdad depende del factor tiempo, si lográramos despejar el factor tiempo de la ecuación tendríamos vida eterna, ya que el tiempo no pasaría jamás y seríamos inmortales como Gilgamesh. Según recientes estudios cientificos, la muerte fue inventada por Dios para no superpoblar el planeta y dar oportunidades a todos (se imaginan si los Kirchner gobernaran eternamente?, serían dueños de todas las galaxias del universo... y eso no es justo). La muerte puede sucederle a cualquiera de un millón de modos distintos. Usted podría ser pegado un tiro, comido, atropellado, volado, roto, quemado, apuñalado, ahogado, o matado. Ya que el morir es el final de vida, muchas personas creen es importante hacer un espectáculo grande de ello y tratan de morir por actividades peligrosas como el paracaidismo, la pesca, y la conversación fuerte en bibliotecas.

[editar] Conclusión

Como todo lo que comienza, tiene su fin (exepto por ciertos orgasmos). Llega un momento en que la vida debe terminarse. O no. Espere, un segundo ... sí. Uhh ... no. Independientemente de eso. Uno puede morir, o ser convertido en un tipo inmuerto, o quizás, con un poco de suerte, conocer a algún Dios que le permita "vivir para siempre". Como con el principio, el final de vida es un tema a menudo discutido a pesar de ser inútil para alguien vivo. Si usted alguna vez se ha preguntado que pasa después de la vida, no se preocupe por ello demasiado. Usted lo averiguará en aproximadamente cinco minutos...

¡¡¡¡¡¡¡¡¡¡¡¡ADVERTENCIA!!!!!!!!!!!!!

LA VIDA PUEDE OCASIONAR LA MUERTE

[editar] Modelo de vida matemático

Este tipo ha propuesto un modelo matemático sobre la vida, donde x es la edad. Él ha admitido a haber encontratado en ella cual es el sentido de la vida, pero nadie le comprende. El resultado de esta sencilla fórmula debería dar 42.

Vida = \frac{-100}{(x^2-18)(3\sqrt{2\pi})}    .    e^{\frac{(x-18)^2}{18}}   +   0.1329     for  x  :  0 < x < 80

El análisis ampliado de esta ecuación causará a matemáticos la explosión de su cráneo espontáneamente. Paradógicamente, si tienes entre tus planes el resolver y analizar esta fórmula, entonces no tienes vida.

[editar] Así es como el vive ADN

Cita3GATCGATCGACTAGATCGTAGTAGGAAGAGCTAAGTCATCGAGAGGTCAAGAGCTGAGCTGATCCTAGCTCCita4
ADN sobre la vida
Incitables1
Incitables alberga una
colección de frases
célebres de o sobre


[editar] ¿Sabías que...

  • ...la muerte está tan segura de vencer que nos da toda una vida de ventaja?
  • ...los gatos tienen siete vidas?
  • ...nadie sale vivo de la vida?
  • ...la vida es una broma?
  • ...todo en la vida tiene solución?
  • ...si estás leyendo esto no tienes vida? Русский
Herramientas personales